Saturday, January 5, 2019

Youtube daily report Jan 5 2019

Cozy Beautiful SHED Cabin Tiny House in Belleville, Kansas

For more infomation >> Cozy Beautiful SHED Cabin Tiny House in Belleville, Kansas - Duration: 2:21.

-------------------------------------------

Eriba Nova GL 465 - Duration: 1:12.

For more infomation >> Eriba Nova GL 465 - Duration: 1:12.

-------------------------------------------

Absolutely Modern Park Model on a Luxury Camping Retreat in Central Texas - Duration: 1:34.

Amazing Cozy Beautiful Tiny Terrapin House For Sale in OR

For more infomation >> Absolutely Modern Park Model on a Luxury Camping Retreat in Central Texas - Duration: 1:34.

-------------------------------------------

nice little Cottage Solar Powered Tiny Cabin on Stilts in Belize - Duration: 2:29.

nice little Cottage Solar Powered Tiny Cabin on Stilts in Belize

For more infomation >> nice little Cottage Solar Powered Tiny Cabin on Stilts in Belize - Duration: 2:29.

-------------------------------------------

12 Gays of Christmas: Russell T Davies (cc) - Duration: 6:24.

On the 12th Gay of Christmas...... Apprently it's over

*Bells Tolling*

Hi guys i'm Shelly, welcome back to my channel and the 12 Gays of Christmassssss....

I'm going all out, it's the 12th day. I should have more energy than this. But I'm very tired by now.

Anyway Ladies & Gentlemen, Boys & Girls, Non-Binary and for those of you, who have yet to decide.

May I present to you..... Russell T Davis

I may get emotional in this one, this guy means a lot to me.

Russell is a Welsh screenwriter and TV producer,

known for creating Queer as Folk and the regeneration of Doctor Who.

Born in Swansea, in April 1963 his parents were both teachers.

He grew up in a household that never switched the TV off.

It was always running in the background until closed down.

Yes, closed down actually existed. There was a time when the TV stopped transmitting!

And he grew up watching I Claudius, and Doctor Who.

In fact, one of his first memories he says, is watching Doctor Who.

At age 14 he auditioned and joined the newly formed Westland Glamorgan Youth Theatre Company.

Working within this group, allowed him to grow and define his sexual identity and come out as gay.

And in 1981 he was accepted by Worcester College, Oxford to study English literature.

While he studied at Oxford he continued to write scripts and be connected with the Western Glamorgan Youth Theatre.

And in 1984 he made his last performance and then signed up to Cardiff University for theatre studies.

In 1985 Russel started his professional TV career. After a friend suggested him as a graphic artist for the children's TV show. 'Why Don't You'

Does anybody remember it? I think I used to watch it?

He worked his way up the ladder on the show, and ended up becoming the producer.

In 1993 he wrote script for the TV show 'Children's Ward',

that featured a teenage boy who had been infected with HIV through a blood transfusion.

That challenged the assumption at the time, that only gay men contracted the disease.

While working on various TV shows Russell had a crisis, after almost dying from an accidental overdose.

The experience persuaded him to detoxify, and make a name for himself,

as a producer of his own series, that would celebrate homosexuality.

Can you guess where I'm going with this???

Queer as Folk was born.

Which is a series about a group of friends in the Manchester gay scene.

The series deals with realistic discussions about sex, and relationships, and queer bashing.

Russell's character 's had sex! They were funny, they had relationships, they were real.

They had a party scene on Canal Street that had never been shown before.

A little bit of trivia that kind of just made me go, really????

Is that Russell wanted Chris Eccleston to play Stuart!

Chris Eccleston, then going on to work with Russell and other things including Doctor Who.

Can you imagine Chris Eccleston as Stuart???? It would have been interesting, but he turned it down.

The series transmitted in early 1999, when parliament was discussing LGBT equality.

And the series aired, its first episode aired. The day the House of Lords was discussing the sexual offence bill.

Which eventually reduced the age of consent for homosexual sex to 16.

There were a 136 complaints to OFCOM, which is the UK TV regulators.

About sexual content in the first episode of Queer as Folk, and the rest of it to be honest.

And as it goes, some advertisers pulled out.

Moving on, the next TV series that Russell did was Bob & Rose on ITV.

Based on a gay friend of his, who had then fallen in love and married a woman and had a child.

Russell's work focuses on love in every form, it breaks down barriers.

And like Queer as Folk before it, Bob & Rose contributed to the wider discussion of gay rights.

A subplot of the series included demonstrations and protests about Section 28 which was going on at the time.

Section 28. that prohibited promotion of homosexuality in any way.

And I'm not talking you know, I'm gay you should be too.

I'm saying like, you couldn't have a gay teacher, you couldn't have a gay councilman.

Because apparently that was promoting homosexuality.

I could carry on pretty much forever on this video, about the stories that Russell T Davis has told.

From the Second Coming, to Mine All Mine, to Casanova......

and then of course the reboot of Doctor Who and Captain Jack Harkness alone!!!!!

All adding up to how Russell tells a wonderfully inclusive story. That bought lgbtqia+ rights into people's homes,

At the same time it that it was happening in Parliament, or in their newspapers at their schools.

He was showing lgbtqia+ stories with emotion, with humanity.

It was making it normal for people who didn't think it was normal.

He changed people's minds a story at a time.

And personally for me through Doctor Who, and Captain Jack Harkness and many other characters in that series.

He showed me myself, and that was Russell T Davies!

I started this series talking about people who protested, people who put their lives on the line,

and the livelyhood, and their minds and their bodies in the way of danger. So that we could be free.

And now we have the storytellers, who are telling their stories.

Who are making history by bringing in the humanity. By showing people who don't necessarily like gay people.

That we are human too, and we have a right to our history.

And we have a right to be human, and we have a right to love.

Bringing that into people's living rooms, and shining a light on it.

So from the very beginning, to the very end,

These 12 people are fighting for lgbtqia+ to be normal, to have rights, to be like everybody else.

And I am so very grateful to all of them!!!

And that's it, that was day 12. I have learnt a lot during this series, and I'm very grateful to all these people.

And I'm very grateful that I got to to make this series. I really hope that you have enjoyed this series.

Thank you for sticking around if you did, Thank you for joining and and coming to watch this if you are new.

I cannot express the gratitude I feel for that, I will probably make another video about what's happened in the last week.

Because it's been a bit much, I'm a bit I'm a bit overwhelmed, but just.... just

Thank you very much, I hope you had a good Christmas.

I hope that you're having a good New Year! and let's see what 2019 brings......

Byeeeee

I kinda wanna watch Doctor Who now......hmmmm.......OkayBye!

For more infomation >> 12 Gays of Christmas: Russell T Davies (cc) - Duration: 6:24.

-------------------------------------------

I cut all the gameplay from my Hocus Pocus Episode 1 record - Duration: 1:13.

*TAC TAC*

*tssshhk*

and all the new stuff that just happened in this game...

...when he started running the game with Melonax...

good

*tac tac tac tac*

yeah

oh that was pretty good

*tac tac tac tac tac tac*

*TAC*

*tac tac tac tac tac tac tac*

*toc*

It's not gonna make me alone...

...Britney Spears

yeah less than one second, that's good

*tctctctctctctctctctactac*

super early jump, that's...

Bill Nye

*crack*

*tac*

*tac*

wet... there's always threesome

Ok good

*tctctctctctctctctctctctctctctctctctctcctctctctctctctctcctctctctctctctctctcct*

*inspires*

all of that stuff from the TAS...

...won

look at that gold,

NICE

*TACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTAC*

For more infomation >> I cut all the gameplay from my Hocus Pocus Episode 1 record - Duration: 1:13.

-------------------------------------------

Kia cee'd 1.4 T-GDi 140pk EXECUTIVELINE 18" - LEDER - LED - Duration: 1:11.

For more infomation >> Kia cee'd 1.4 T-GDi 140pk EXECUTIVELINE 18" - LEDER - LED - Duration: 1:11.

-------------------------------------------

Kia Sportage 1.6 GDI 135pk ExecutiveLine - slechts 41dkM - Full Options - Duration: 1:04.

For more infomation >> Kia Sportage 1.6 GDI 135pk ExecutiveLine - slechts 41dkM - Full Options - Duration: 1:04.

-------------------------------------------

Opel Astra 1.4 Turbo 150pk Innovation Navi camera 18 inch AGR - Duration: 1:12.

For more infomation >> Opel Astra 1.4 Turbo 150pk Innovation Navi camera 18 inch AGR - Duration: 1:12.

-------------------------------------------

2019 में आया Whatsapp का नया FEATURE ! OMG ! इतने कमाल का मज़ा ही आ गया यार | WHatsapp Tricks 2019 - Duration: 7:37.

For more infomation >> 2019 में आया Whatsapp का नया FEATURE ! OMG ! इतने कमाल का मज़ा ही आ गया यार | WHatsapp Tricks 2019 - Duration: 7:37.

-------------------------------------------

Renault Mégane 1.5 Energy dCi 110 pk S&S ECO FAP Expression - Duration: 1:03.

For more infomation >> Renault Mégane 1.5 Energy dCi 110 pk S&S ECO FAP Expression - Duration: 1:03.

-------------------------------------------

Opel Corsa 1.4 16V Business + Nav. Clim.contr. Trekh. - Duration: 1:08.

For more infomation >> Opel Corsa 1.4 16V Business + Nav. Clim.contr. Trekh. - Duration: 1:08.

-------------------------------------------

Kia cee'd 1.6 Comfort Pack met Cruise, Airco, Navi en 7jr garantie - Duration: 1:02.

For more infomation >> Kia cee'd 1.6 Comfort Pack met Cruise, Airco, Navi en 7jr garantie - Duration: 1:02.

-------------------------------------------

Peugeot 108 1.0 e-VTi 68pk 5D Active - Duration: 1:12.

For more infomation >> Peugeot 108 1.0 e-VTi 68pk 5D Active - Duration: 1:12.

-------------------------------------------

CHRIS REA ❄️ Winter Song - Duration: 4:41.

For more infomation >> CHRIS REA ❄️ Winter Song - Duration: 4:41.

-------------------------------------------

I   K n o w   Y o u ' r e   S o m e w h e r e  //  T o b i X K o n a n - Duration: 1:34.

🔥 Trxsh Gxng 🔥

For more infomation >> I   K n o w   Y o u ' r e   S o m e w h e r e  //  T o b i X K o n a n - Duration: 1:34.

-------------------------------------------

タジマEVが2020HP・600Nm・0-100km/h加速1.95秒の6輪ハイパーEV「MONSTER E-RUNNER Kode6」を年内発売! - Duration: 8:50.

For more infomation >> タジマEVが2020HP・600Nm・0-100km/h加速1.95秒の6輪ハイパーEV「MONSTER E-RUNNER Kode6」を年内発売! - Duration: 8:50.

-------------------------------------------

Mấy Giờ Rồi Em? - Ryco - Duration: 3:01.

For more infomation >> Mấy Giờ Rồi Em? - Ryco - Duration: 3:01.

-------------------------------------------

🎮ИГРОВЫЕ ПРИКОЛЫ №104 [18+] THE BEST GAME COUB | Баги,фейлы - Duration: 10:26.

For more infomation >> 🎮ИГРОВЫЕ ПРИКОЛЫ №104 [18+] THE BEST GAME COUB | Баги,фейлы - Duration: 10:26.

-------------------------------------------

S ОБРАЗНЫЕ СМЕСИТЕЛИ ЛАБОРАТОРНЫЕ Minipress.ru - Duration: 1:21.

For more infomation >> S ОБРАЗНЫЕ СМЕСИТЕЛИ ЛАБОРАТОРНЫЕ Minipress.ru - Duration: 1:21.

-------------------------------------------

СМЕСИТЕЛИ Z ОБРАЗНЫЕ ПЕРИОДИЧЕСКОГО ДЕЙСТВИЯ Minipress.ru - Duration: 1:21.

For more infomation >> СМЕСИТЕЛИ Z ОБРАЗНЫЕ ПЕРИОДИЧЕСКОГО ДЕЙСТВИЯ Minipress.ru - Duration: 1:21.

-------------------------------------------

СМЕСИТЕЛЬ Z ОБРАЗНЫЕ ЛОПАСТИ Minipress.ru - Duration: 1:21.

For more infomation >> СМЕСИТЕЛЬ Z ОБРАЗНЫЕ ЛОПАСТИ Minipress.ru - Duration: 1:21.

-------------------------------------------

В ОБРАЗНЫЕ СМЕСИТЕЛИ ДЛЯ ФАРМАЦЕВТИКИ Minipress.ru - Duration: 1:21.

For more infomation >> В ОБРАЗНЫЕ СМЕСИТЕЛИ ДЛЯ ФАРМАЦЕВТИКИ Minipress.ru - Duration: 1:21.

-------------------------------------------

Serious d?j? vu - Duration: 23:44.

For more infomation >> Serious d?j? vu - Duration: 23:44.

-------------------------------------------

😮We MOVED to PUERTO RICO🎉 - Duration: 12:03.

For more infomation >> 😮We MOVED to PUERTO RICO🎉 - Duration: 12:03.

-------------------------------------------

I Bought a $2,000 MIDI Controller?!? - Duration: 9:53.

is the most fun I've had with a plug-in instrument in a long time

what's up guys a couple months ago I bought a hardware synthesizer the profit

6 by sequential I've bought it because it produces beautiful sounds now if you

want to know more about why I chose that synth and another synth that I have the

cord mini log watch this video but today I'm using the profit 6 as a MIDI

controller that's right a $2,000 MIDI controller which means I'm not even

using the sounds the beautiful sounds that this thing can create here's why

I'm controlling omnisphere with omnisphere 2.5 you can control many

aspects of the sound with an external hardware synth there are a bunch of

hardware cents that can control it including some much cheaper ones like

the Korg mini log for $500 I'll demo that in just a moment but let me tell

you using the profit 6 to control omnisphere

is the most fun I've had with a plug-in instrument in a long time to use any of

the compatible hardware sense with omnisphere you just need to select it

from the hardware menu at the top it maps all the controls automatically so

it's easy to start modifying controls because it's all labeled on your synth

in addition to controlling and modifying all of the omnisphere patches you get

some additional patches in the hardware library actually all the presets that

are optimized for control on the various compatible hardware sense are here so

even if you don't have one of those hardware since you can access all of

them the profit 6 can control a bunch of different things

oscillators 1 and to control the layers in omnisphere

you can change the shape of the waves

sub octave add some bass to any sound

and of course you've got the high and low-pass filters

you can also control unison envelopes LFO the arpeggiator and even the effects

I love that the ominous tear panels switch depending on which knob you're

controlling controlling cutoff it automatically switches to the cutoff

page either changing the shape of a wave it switches to that page it's so much

easier than using the mouse to navigate different windows depending on what you

want to control now let's hear what it can do in a song that I created for this

song I'm using all omnisphere patches and nothing else the drums are coming

from samples

all right that was so much fun but let's talk about a cheaper alternative the

Korg mini log the cork mini log is also compatible with omnisphere so you can

control some things but the mini log is much more limited with what you can

control

I had some good results controlling the oscillators and changing the shapes and

of course cutoff and resonance is always fun to play with but LFO was a bit more

complex I just didn't have as much fun controlling on the sphere with a mini

log than I did with the Prophet six so if you're looking for a more inexpensive

option to control omnisphere I'd suggest looking at the Roland SEO 2

it's small compact and has a lot better control of on the sphere and of course

you get the hardware synth sounds that it makes I'm not telling you that you

should go out and buy a hardware stand just to control omnisphere but if you

have a compatible synth lying around I highly recommend that you give this a

try you're gonna have a whole lot of fun now if you don't own omnisphere

but you have one of the compatible hardware since this may be a good reason

to buy on the sphere I mean it's that much fun

and of course honest fear has top-notch sounds just on its own I hope you

enjoyed this video please hit the like button and don't forget to subscribe

keep making the music that you love and I will see you guys

For more infomation >> I Bought a $2,000 MIDI Controller?!? - Duration: 9:53.

-------------------------------------------

Aquí hay SEIS Nudos, Mira y APRENDE!!... con ellos ya puedes armar diversas Líneas de PESCA - Duration: 16:11.

For more infomation >> Aquí hay SEIS Nudos, Mira y APRENDE!!... con ellos ya puedes armar diversas Líneas de PESCA - Duration: 16:11.

-------------------------------------------

MES CADEAUX DE NOËL 2018 ! - Duration: 11:37.

For more infomation >> MES CADEAUX DE NOËL 2018 ! - Duration: 11:37.

-------------------------------------------

Peugeot 108 1.0 e-VTi Active TOP! - Duration: 1:04.

For more infomation >> Peugeot 108 1.0 e-VTi Active TOP! - Duration: 1:04.

-------------------------------------------

BMW 1 Serie 116i Business Line 5drs / AIRCO / PDC / TREKHAAK - Duration: 1:05.

For more infomation >> BMW 1 Serie 116i Business Line 5drs / AIRCO / PDC / TREKHAAK - Duration: 1:05.

-------------------------------------------

Suspects sought in Circle K armed robbery - Duration: 0:21.

For more infomation >> Suspects sought in Circle K armed robbery - Duration: 0:21.

-------------------------------------------

I   K n o w   Y o u ' r e   S o m e w h e r e  //  T o b i X K o n a n - Duration: 1:34.

🔥 Trxsh Gxng 🔥

For more infomation >> I   K n o w   Y o u ' r e   S o m e w h e r e  //  T o b i X K o n a n - Duration: 1:34.

-------------------------------------------

Yunomi (feat. Rinahamu) - Fashion - Duration: 4:05.

For more infomation >> Yunomi (feat. Rinahamu) - Fashion - Duration: 4:05.

-------------------------------------------

(ENG SUB)CAN YOU GUESS 25 KPOP GROUPS BY EMOJIS?? - Duration: 11:17.

I don't know

Hello everyone. This is GoToe!!!

We gonna do KPOP game today

Game is so simple

Guess KPOP idol group with emoji

We have 25 questions

I don't need extra explanation I think

Let's do it!!!

I need to go to Karaoke after editing this video

This song is new song of MAMAMOO

WINDFLOWER

Part one means the name of group

They will do other things in Part 2 maybe

That is kind of... practice

Everytime when I did KPOP game I felt it

First few questions are so easy normally

Personally My bias in APINK is HAYOUNG

I got it

Normally in KPOP game

Foreigner made this video

So we need to think every emoji and group title

with ENGLISH

Not KOREAN

ID CARD???

(I was so surprised by myself)

That's why I love KPOP game

I feel so good when I did it

I think I can get 100 score today

Everyone know this I think

Answer is name of idol groups

Not a name of title song or sth

So it is easy to know the answer

Their last song was YESTERDAY right??

It was so long time ago

Moderate question

KARD is famous in abroad I think

but not in Korea yet

I want to tell you everyone who see this video in Korea

Please listen their songs.....

They debuted in 2012 and have 4 members

I didn't listened their songs a lot

AMAZING

That why I did this game

That was amazing moment

Personally I think this is... WINNER

LUCKY DAY

Personally I really like their new songs... MILLIONS

I love their choreo too

They changed members bcz of their contraction I think

I don't know well about their recent work

I don't know anything

TVXQ!!!!!!!!!!!!!!!!!!!

That feeling is so toxic to me

That's crazy.... I feel so good today

It is so simple like question 1 to us

Personally I really likw JENNY in Blackpink

I am support them

I think I got 100 score today

They also need more fame in Korea I think

They have many good songs and I recommend LET ME

What is 2nd one...? Chicken????

I will eat chicken after go Karaoke

COSMIC girl!!!!

I feel so good today

Recently, COSMIC GIRLS

they changed their members

bcz of their CHINA activity as I known

I know it just after seeing it

They are focus on their personal activity nowadays

I saw many Groups of memories

I got everything except one

What is the last picture??

Sleeping???

Their choreo is really hard,, I think NO.1

I love choreo of YOU AND ME

That is a good question

Part 2's emoji is about their title song

BTS

Do you understand, right??

Every emoji express title song

RUN, FIRE, DNA

I think I will do this well

I just know when I see the first

actually I am not sure

TWICE......?????

NO~~~~~~~~

HEROINE and

FULL MOON

what is the last one???

I thought that is SANA is their MV scene

Do you know what I am talking about??

That is a good question

So nice question

WOLF, LUCKY ONE

and POWER

I really like this PART2 questions, so interesting

That was RED not RED FLAVOR

RED and

ICE CREAM and BABE

let me think

What...?

Aha,, I know their song LACTUS

That was hard to Korea

This is so interesting

I think it is 100%

1st one is HAPPINESS

ICE CREAM CAKE

Say something

and BAD BOY

1st one is A

last one is NEVER EVER and I am not

sure about the 2nd one

I just felt that was GOT7

FX

I am doing so good today

3rd one is electric shock

middle is HOT SUMMER

and RED LIGHT

let me check...

VIXX when I see the 1st dynamite

I am not sure about 2nd and 3rd one....

I missed one 2 today???

SNSD

wow perfect~!!

LION HEART

PARTY

and GENIE

That was so interesting

Yes we did GUESS the KPOP IDOL GROUPS with EMOJI

I think I did so well today, total 25 questions

I feel I got more than 20 today

What is your score??

I thought many times quality of question is so nice

It was really good time to me today

Just leave a comment about your score

Thank you for watching

See you in my next video

For more infomation >> (ENG SUB)CAN YOU GUESS 25 KPOP GROUPS BY EMOJIS?? - Duration: 11:17.

-------------------------------------------

Best Satifying Chocolate Cake Ideas 🍔🍉🧀 Easy Chocolate Cake Tutorial Videos 2019 - Duration: 10:03.

Best Satifying Chocolate Cake Ideas | Easy Chocolate Cake Tutorial Videos 2019

Thank you for watching! Hope you enjoy & like it!

For more infomation >> Best Satifying Chocolate Cake Ideas 🍔🍉🧀 Easy Chocolate Cake Tutorial Videos 2019 - Duration: 10:03.

-------------------------------------------

How To Decorate Cookies Objects, For Beginners 2019🍪 Best Sugar Cookies - Duration: 10:08.

How To Decorate Cookies Objects, For Beginners 2019🍪 Best Sugar Cookies

Thank you for watching! Hope you enjoy & like it!

For more infomation >> How To Decorate Cookies Objects, For Beginners 2019🍪 Best Sugar Cookies - Duration: 10:08.

-------------------------------------------

Opel Astra 1.4 Turbo 150pk Innovation Navi camera 18 inch AGR - Duration: 1:12.

For more infomation >> Opel Astra 1.4 Turbo 150pk Innovation Navi camera 18 inch AGR - Duration: 1:12.

-------------------------------------------

Tao Không Để Cho Chúng Mày Làm Trò Đùa Nhá-dare to troll my cat is not easy - Duration: 1:30.

For more infomation >> Tao Không Để Cho Chúng Mày Làm Trò Đùa Nhá-dare to troll my cat is not easy - Duration: 1:30.

-------------------------------------------

Nissan Note 1.2 80pk Acenta - Duration: 1:12.

For more infomation >> Nissan Note 1.2 80pk Acenta - Duration: 1:12.

-------------------------------------------

[INDO SUB/ENG SUB] RUN BTS 2019 Behind The Scene EP.57 - Duration: 8:24.

5 5

Oh , I do not like it.

It's an item guy. Originally British people who cook

Here's to La Jagi. Marley's multiple staining ahjeurael geoe Yeah I've ruined so later that same

For us to stay and not leave at all, and that's been two years now mwogo examples Born again all parties 10 days three times haebwatseupnida's only eight years of local

I saw you guys and they did something. Zerg it is thought he will save me. So I'm more different colors

Yesterday horn that goes off by opening and operating scent should last a good long time plan Section 8 eopji turned five angetjyo Incoming

Then we revised why it seems to have closed the offer and also today pasta Try and get the cheap ones.

4 Ah lead sacrifice the first flare so I know a good way to get some yet To say that today is what some children want to be put together like a long

I'm good at it. Da Wang is thinking squat , Plate if the water is gathered Akiko Illustration What mean only the cases detected Oh

I have to have a synagogue There's something like this on page 64. What a workable sensibility he who does not have Yes our good lasers

It is time. All of you.

0 0 pants

If you're gone, you can get it out and drink it. One thing

* Although the obligation to receive and dont think they make four hearts You must make this in the next

If you make Sany one hand as you're creating 100 Igea life Hammock, I do not know it's a stage.

By hasilji book says 5 October

I bought wer puppy Haha to hamkkehan mistaken name

Anneyo hangeo do not get it all the way to one with nine minutes Articles For almost touches where we go haget not kkulril bag more cooking something like this

Ahh ah ah ah ah nya lead The society goes through a day and there is no harm

I heard the explanation . Ah yes.

Woah I do not know if this is right .

Look at you. For example, what's the ah earlier water harness ingonggi See you. I was very happy about An's.

Please rest assured that this is the time o 5

[music] 2way

Say it there

cowon w2

What now Black people with oem team do not get expensive

What about the once muscular'll come up to us Oh my gall contents of ballot boxes allowed I talked about using it .

The drama's early ashraine Millet Our daughter and two great-minute as this was a little fake so what disease

Yes, once about ge 2gb 1 simulated one-time basis and garlic

4 We have to study too much to question the dog awakening and consider it boring It does not have to be yours, but it's important in fields where you have to train.

This is so that the two glasses and 4 I do not read it

In our opinion It always shows

Uh shape social commentary What the rituals performed to clap for me this is our time Vacation of life and death

As I have spoken at the place where I wiped it hard I will fight with others and I will plan

Yes The cr is attached to the Republic of Korea by Loro Loro Loro Loro Loro

There is a restaurant on the ground floor. There is a restaurant on the ground floor.

There is a restaurant on the ground floor. I have been spoiled 204 to look at my plus or minus

My son is now People are asking for the denominational sect

Is it possible to give Silom a room I can raise the spy. I need to check what's on my daughter 8. Come in . Young

The promise of sex 2 Yeah ep.33 please change

Okay enough to 4 Life once M malhasin that from now on I guess.

4 Like Earth, I'm sorry.

Slightly older

I think so. When I met Rain, I just felt good and I looked out.

3 cases It's easy to get liquids, you'll get the siren there.

The problem is that the baby's stress is supposed to be oo Please come in. Ask me if you like this.

So no beautiful I should put it in my debt .

I do not have time then. Now you have to be first for the source.

Chef of Macau I was sick and I failed. It's pretty, but as I try to hurt you, what do I look like?

This is how her team to keep Hoi hiding pledged Shovel played golf It's melted.

Ah ah ah Mocha what it once regretted coming a peninsula road in the country you awake You'll be hit .

I made it with a steak, and I put it on honey . It 's better to have a green ground

Kohler seemed unhappy in the whole thanks to a patch 53 shots midfield People Iteunikka can make a cool sweetness but also falls Please plate and bend the product

Two people are dying of decaying church laws to spice it up properly Promotion is now gathering ZE is an old word that checks the topography talk to the earth

True to two people talking is what your going round That's what I need to boil.

Do you know what I'm talking about with egg yolk ? It's baseball . This stage to obtain a real plate and wire industry was as diplomatic go

So even when difficult now that the last button fell and teeth is such Two euros - Full Description - What are you doing so I lay before I go to the beginning Tommy said that grown up without cooking Fair Besides, why I, too, lay fiction

Why are you going to love it? Too often in the future yireongeot I lived in Greece Sharjah liger Aguirre

Even if it's called color

No comments:

Post a Comment